Table 3. Sequences of oligonucleotides synthesised with weighted base mixtures
Network+ geneWeighted oligonucleotide for randomisation (5′→3′)
OG redCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGTTCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCGAATTCATTTCACC
OG blueATTGGAATTCTTTATGGCTAGCTCAGTCCTAGGTACAATGCTAGCGAAGGGTCCCTATCAGTGATAGAGAGAGCTCGTTGAGTTACCTGC
OG greenATTGGAATTCTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCGAAGGGAATTGTTATCCGGATAACAATTCCGAGCTCGTTGAGTTACCTGC
CG redCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGTTCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCGAATTCATTTCACC
CG blueATTGGAATTCATTTTGGTGACACTATAGAAGGGGCCAAGCAGGGGGCCAAGCAGGGGGCCAAGGAGCTCGTTGAGTTACCTGC
CG greenATTGGAATTCTAATACGACTCACTGTAGGGGAATTGTTATCCGGATAACAATTCCGAGCTCGTTGAGTTACCTGC
CG green mutant AATTGGAATTCTAATACGACTCACTGTAGGGGAATTGTTAACCGGATAACAATTCCGAGCTCGTTGAGTTACCTGC
CG green mutant BATTGGAATTCTTAATACGACTCACTGTAGGTGAATTGTTATCCGGATAACATTCCGAGCTCGTTGAGTTACCTGC
  • The underlined region was randomised, and the remaining sequence was constant.

  • OG, opposing gradient network; CG, concurring gradient network.