Table 5. Sequences of primers used for sequencing
NameSequence (5′→3′)Used to sequence
pET_SeqCCGAAAAGTGCCACCTGACOG green
pET_Seq_AmpGACACGGAAATGTTGAATACTCATACCG green, OG green
pBAD_fGCCGTCACTGCGTCTTTTACOG red, CG red
pCDF_Seq_oriGAGTTCGCAGAGGATTTGTTTAGCOG blue, CG blue
pCDF_I2_revTCTACTGAACCGCTCTAGOG blue