Table 2. Primer sequences used in the study
GeneForward PrimerReverse Primer
Oct4 AGTTGGCGTGGAGACTTTGCCAGGGCTTTCATGTCCTGG
Nanog TTGCTTACAAGGGTCTGCTACTACTGGTAGAAGAATCAGGGCT
Sox2 GCTCGCAGACCTACATGAACGCCTCGGACTTGACCACAG
Otx2 TATCTAAAGCAACCGCCTTACGAAGTCCATACCCGAAGTGGTC
Eomes GGCCCCTATGGCTCAAATTCCCCTGCCCTGTTTGGTGATG
Gata6 GGCAGTGTGAGTGGAGGTGTGGTACGTTCCGTTCAGCG
Gata4 CCCTACCCAGCCTACATGGACATATCGAGATTGGGGTGTCT
Trop2 GTCTGCCAATGTCGGGCAAGTTGTCCAGTATCGCGTGCT
Fgf5 TGTGTCTCAGGGGATTGTAGGAGCTGTTTTCTTGGAATCTCTCC
Bry (T) GCTGGATTACATGGTCCCAAGGGCACTTCAGAAATCGGAGGG
b‐actin GAAATCGTGCGTGACATCAAAGTGTAGTTTCATGGATGCCACAG
Furin TCGGTGACTATTACCACTTCTGGCTCCTGATACACGTCCCTCTT
Gata3 AAGCTCAGTATCCGCTGACGGTTTCCGTAGTAGGACGGGAC
Elf5 GACTCCGTAACCCATAGCACCGCTGAACAGATCGGTCCAAGG
Tfap2c TACCAGCCGCCTCCTTACTTTCCAGCCCTGAAATATGGGGT
Hand1 GGCAGCTACGCACATCATCAGCATCGGGACCATAGGCAG